Review




Structured Review

Twist Bioscience msi2 constructs
(A) Schematic of the tethering-based luciferase reporter assay using <t>λN-GFP-MSI2</t> fusion proteins and a bidirectional luciferase reporter. (B) Domain architecture of tethering constructs used in characterization assays. (C) NanoLuc/Firefly luciferase ratios following expression of the indicated tethering constructs in H295R cells (n = 6), normalized to λN-GFP control (red line). (D) Relative NanoLuc reporter mRNA expression measured by RT-qPCR (n = 3), normalized to λN-GFP control (red line). (E) Schematic of the Musashi binding element (MBE) luciferase reporter constructs targeted by endogenous <t>MSI2.</t> (F) NanoLuc/Firefly luciferase ratios from MBE reporter assays in MSI2 WT and MSI2 KD H295R cells (n = 6), normalized to MSI2 WT cells. Statistical significance was determined using Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001.
Msi2 Constructs, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/msi2 constructs/product/Twist Bioscience
Average 86 stars, based on 1 article reviews
msi2 constructs - by Bioz Stars, 2026-06
86/100 stars

Images

1) Product Images from "Isoform-Specific Localization Diversifies Human MSI2 Function"

Article Title: Isoform-Specific Localization Diversifies Human MSI2 Function

Journal: bioRxiv

doi: 10.64898/2026.05.16.725683

(A) Schematic of the tethering-based luciferase reporter assay using λN-GFP-MSI2 fusion proteins and a bidirectional luciferase reporter. (B) Domain architecture of tethering constructs used in characterization assays. (C) NanoLuc/Firefly luciferase ratios following expression of the indicated tethering constructs in H295R cells (n = 6), normalized to λN-GFP control (red line). (D) Relative NanoLuc reporter mRNA expression measured by RT-qPCR (n = 3), normalized to λN-GFP control (red line). (E) Schematic of the Musashi binding element (MBE) luciferase reporter constructs targeted by endogenous MSI2. (F) NanoLuc/Firefly luciferase ratios from MBE reporter assays in MSI2 WT and MSI2 KD H295R cells (n = 6), normalized to MSI2 WT cells. Statistical significance was determined using Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001.
Figure Legend Snippet: (A) Schematic of the tethering-based luciferase reporter assay using λN-GFP-MSI2 fusion proteins and a bidirectional luciferase reporter. (B) Domain architecture of tethering constructs used in characterization assays. (C) NanoLuc/Firefly luciferase ratios following expression of the indicated tethering constructs in H295R cells (n = 6), normalized to λN-GFP control (red line). (D) Relative NanoLuc reporter mRNA expression measured by RT-qPCR (n = 3), normalized to λN-GFP control (red line). (E) Schematic of the Musashi binding element (MBE) luciferase reporter constructs targeted by endogenous MSI2. (F) NanoLuc/Firefly luciferase ratios from MBE reporter assays in MSI2 WT and MSI2 KD H295R cells (n = 6), normalized to MSI2 WT cells. Statistical significance was determined using Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001.

Techniques Used: Luciferase, Reporter Assay, Construct, Expressing, Control, Quantitative RT-PCR, Binding Assay

(A) Schematic representation of MSI2-328 domains and their corresponding amino acid positions. (B,D) Schematics of MSI2 tethering constructs used in the reporter assays. (C,E) NanoLuc/Firefly luciferase ratios in H295R cells expressing the indicated tethering constructs (n = 6), normalized to λN-GFP control (red line). Statistical significance was determined using Student’s t-test relative to λN-GFP. (F) FLAG immunoprecipitation followed by western blot analysis of endogenous PABPC1 binding to FLAG-MSI2 constructs. FLAG-tagged proteins were immunoprecipitated and blots probed for PABPC1. Input samples (0.5%) are shown on the left and immunoprecipitated samples (50%) on the right. (G) NanoLuc/Firefly luciferase ratios in HEK293 cells following PABPC1 knockdown with two independent siRNAs (n = 4), normalized to λN-GFP control (red line). Statistical significance was determined using Student’s t-test relative to scramble siRNA controls for each construct. *p < 0.05, **p < 0.01, ***p < 0.001.
Figure Legend Snippet: (A) Schematic representation of MSI2-328 domains and their corresponding amino acid positions. (B,D) Schematics of MSI2 tethering constructs used in the reporter assays. (C,E) NanoLuc/Firefly luciferase ratios in H295R cells expressing the indicated tethering constructs (n = 6), normalized to λN-GFP control (red line). Statistical significance was determined using Student’s t-test relative to λN-GFP. (F) FLAG immunoprecipitation followed by western blot analysis of endogenous PABPC1 binding to FLAG-MSI2 constructs. FLAG-tagged proteins were immunoprecipitated and blots probed for PABPC1. Input samples (0.5%) are shown on the left and immunoprecipitated samples (50%) on the right. (G) NanoLuc/Firefly luciferase ratios in HEK293 cells following PABPC1 knockdown with two independent siRNAs (n = 4), normalized to λN-GFP control (red line). Statistical significance was determined using Student’s t-test relative to scramble siRNA controls for each construct. *p < 0.05, **p < 0.01, ***p < 0.001.

Techniques Used: Construct, Luciferase, Expressing, Control, Immunoprecipitation, Western Blot, Binding Assay, Knockdown

(A) Representative immunofluorescence images for endogenous MSI2 (green) and DAPI (blue) (scale bar, 10 μm). (B) - (C) Representative immunofluorescence images for GFP-tagged tethering MSI2-328 variants and mutants (green) and DAPI (blue), (scale bar, 10 μm).
Figure Legend Snippet: (A) Representative immunofluorescence images for endogenous MSI2 (green) and DAPI (blue) (scale bar, 10 μm). (B) - (C) Representative immunofluorescence images for GFP-tagged tethering MSI2-328 variants and mutants (green) and DAPI (blue), (scale bar, 10 μm).

Techniques Used: Immunofluorescence

(A) Schematic representation of MSI2 splice isoforms (MSI2-328 and MSI2-324) with their corresponding Ensembl transcript IDs and amino acid (aa) length. Exons are represented as black boxes, while isoform specific regions are highlighted in blue. (B,E) NanoLuc/Firefly luciferase ratios in H295R cells expressing the indicated tethering constructs, normalized to λN-GFP control. (C) Relative NanoLuc reporter mRNA expression measured by RT-qPCR and normalized to λN-GFP control. (D) Schematic representation of MSI2-324 constructs used for functional assays. Statistical significance was determined using Student’s t-test relative to λN-GFP control. *p < 0.05, **p < 0.01, ***p < 0.001. (F) - (G) Representative immunofluorescence images for GFP-tagged MSI2-324 variants and mutants (green) and DAPI (blue) (scale bar 10 μm).
Figure Legend Snippet: (A) Schematic representation of MSI2 splice isoforms (MSI2-328 and MSI2-324) with their corresponding Ensembl transcript IDs and amino acid (aa) length. Exons are represented as black boxes, while isoform specific regions are highlighted in blue. (B,E) NanoLuc/Firefly luciferase ratios in H295R cells expressing the indicated tethering constructs, normalized to λN-GFP control. (C) Relative NanoLuc reporter mRNA expression measured by RT-qPCR and normalized to λN-GFP control. (D) Schematic representation of MSI2-324 constructs used for functional assays. Statistical significance was determined using Student’s t-test relative to λN-GFP control. *p < 0.05, **p < 0.01, ***p < 0.001. (F) - (G) Representative immunofluorescence images for GFP-tagged MSI2-324 variants and mutants (green) and DAPI (blue) (scale bar 10 μm).

Techniques Used: Luciferase, Expressing, Construct, Control, Quantitative RT-PCR, Functional Assay, Immunofluorescence

(A) Heatmap of row-scaled z-scores of averaged protein intensities from EGFP, FLAG-MSI2-324, and FLAG-MSI2-328 immunoprecipitation mass spectrometry datasets clustered using k-means analysis. (B,C) Overrepresentation analysis of proteins enriched within MSI2-328 or MSI2-324 clusters identified in (A), showing significantly enriched Reactome pathways. (D) Volcano plot comparing protein enrichment between FLAG-MSI2-324 and FLAG-MSI2-328 immunoprecipitations. Significance thresholds were set at p < 0.05 and |log2FC| > 1. Translation-associated proteins enriched with MSI2-328 are highlighted in blue, while chromatin-and nuclear-associated proteins enriched with MSI2-324 are highlighted in orange. (E) Barplot of the number of MSI2 CLIP-seq peaks annotated to different transcript regions. (F) Scatter plot comparing enrichment of 6mers in MSI2 CLIP-seq peaks versus background regions for intronic binding sites (y-axis) and 3’ UTR binding sites (x-axis). The 6mers in red were enriched at least 4-fold in either intronic or 3’ UTR binding sites.
Figure Legend Snippet: (A) Heatmap of row-scaled z-scores of averaged protein intensities from EGFP, FLAG-MSI2-324, and FLAG-MSI2-328 immunoprecipitation mass spectrometry datasets clustered using k-means analysis. (B,C) Overrepresentation analysis of proteins enriched within MSI2-328 or MSI2-324 clusters identified in (A), showing significantly enriched Reactome pathways. (D) Volcano plot comparing protein enrichment between FLAG-MSI2-324 and FLAG-MSI2-328 immunoprecipitations. Significance thresholds were set at p < 0.05 and |log2FC| > 1. Translation-associated proteins enriched with MSI2-328 are highlighted in blue, while chromatin-and nuclear-associated proteins enriched with MSI2-324 are highlighted in orange. (E) Barplot of the number of MSI2 CLIP-seq peaks annotated to different transcript regions. (F) Scatter plot comparing enrichment of 6mers in MSI2 CLIP-seq peaks versus background regions for intronic binding sites (y-axis) and 3’ UTR binding sites (x-axis). The 6mers in red were enriched at least 4-fold in either intronic or 3’ UTR binding sites.

Techniques Used: Immunoprecipitation, Mass Spectrometry, Protein Enrichment, Binding Assay

(A) Western blot analysis of endogenous MSI2 protein expression across the indicated human cell lines. (B,C) NanoLuc/Firefly luciferase ratios from tethering assays performed in the indicated cell lines using MSI2 isoforms and mutant constructs. Reporter activity was normalized to λN-GFP control. Statistical significance was determined using Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001. (D) Stacked bar plot showing the median fraction of splice junction usage from the shared MSI2 exon 11 donor across GTEx tissue types. (E) Boxplots showing percent splice isoform values for the MSI2 exon 11 alternative acceptor event across TCGA cancer cohorts. Each point represents an individual tumor sample. Center lines indicate medians, boxes represent the interquartile range, and whiskers extend to 1.5X the interquartile range.
Figure Legend Snippet: (A) Western blot analysis of endogenous MSI2 protein expression across the indicated human cell lines. (B,C) NanoLuc/Firefly luciferase ratios from tethering assays performed in the indicated cell lines using MSI2 isoforms and mutant constructs. Reporter activity was normalized to λN-GFP control. Statistical significance was determined using Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001. (D) Stacked bar plot showing the median fraction of splice junction usage from the shared MSI2 exon 11 donor across GTEx tissue types. (E) Boxplots showing percent splice isoform values for the MSI2 exon 11 alternative acceptor event across TCGA cancer cohorts. Each point represents an individual tumor sample. Center lines indicate medians, boxes represent the interquartile range, and whiskers extend to 1.5X the interquartile range.

Techniques Used: Western Blot, Expressing, Luciferase, Mutagenesis, Construct, Activity Assay, Control



Similar Products

94
Genecopoeia msi2 expression construct
Msi2 Expression Construct, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/msi2 expression construct/product/Genecopoeia
Average 94 stars, based on 1 article reviews
msi2 expression construct - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

86
Twist Bioscience msi2 constructs
(A) Schematic of the tethering-based luciferase reporter assay using <t>λN-GFP-MSI2</t> fusion proteins and a bidirectional luciferase reporter. (B) Domain architecture of tethering constructs used in characterization assays. (C) NanoLuc/Firefly luciferase ratios following expression of the indicated tethering constructs in H295R cells (n = 6), normalized to λN-GFP control (red line). (D) Relative NanoLuc reporter mRNA expression measured by RT-qPCR (n = 3), normalized to λN-GFP control (red line). (E) Schematic of the Musashi binding element (MBE) luciferase reporter constructs targeted by endogenous <t>MSI2.</t> (F) NanoLuc/Firefly luciferase ratios from MBE reporter assays in MSI2 WT and MSI2 KD H295R cells (n = 6), normalized to MSI2 WT cells. Statistical significance was determined using Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001.
Msi2 Constructs, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/msi2 constructs/product/Twist Bioscience
Average 86 stars, based on 1 article reviews
msi2 constructs - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

Image Search Results


(A) Schematic of the tethering-based luciferase reporter assay using λN-GFP-MSI2 fusion proteins and a bidirectional luciferase reporter. (B) Domain architecture of tethering constructs used in characterization assays. (C) NanoLuc/Firefly luciferase ratios following expression of the indicated tethering constructs in H295R cells (n = 6), normalized to λN-GFP control (red line). (D) Relative NanoLuc reporter mRNA expression measured by RT-qPCR (n = 3), normalized to λN-GFP control (red line). (E) Schematic of the Musashi binding element (MBE) luciferase reporter constructs targeted by endogenous MSI2. (F) NanoLuc/Firefly luciferase ratios from MBE reporter assays in MSI2 WT and MSI2 KD H295R cells (n = 6), normalized to MSI2 WT cells. Statistical significance was determined using Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001.

Journal: bioRxiv

Article Title: Isoform-Specific Localization Diversifies Human MSI2 Function

doi: 10.64898/2026.05.16.725683

Figure Lengend Snippet: (A) Schematic of the tethering-based luciferase reporter assay using λN-GFP-MSI2 fusion proteins and a bidirectional luciferase reporter. (B) Domain architecture of tethering constructs used in characterization assays. (C) NanoLuc/Firefly luciferase ratios following expression of the indicated tethering constructs in H295R cells (n = 6), normalized to λN-GFP control (red line). (D) Relative NanoLuc reporter mRNA expression measured by RT-qPCR (n = 3), normalized to λN-GFP control (red line). (E) Schematic of the Musashi binding element (MBE) luciferase reporter constructs targeted by endogenous MSI2. (F) NanoLuc/Firefly luciferase ratios from MBE reporter assays in MSI2 WT and MSI2 KD H295R cells (n = 6), normalized to MSI2 WT cells. Statistical significance was determined using Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001.

Article Snippet: MSI2 constructs were ordered from Twist Biosciences Corporation with a 5’ flank sequence of CAGGTGTCGGTACCGCGGGCCCGGGATCCA and a 3’ flank sequence of CTGGCTCACAAATACCACTGAGATC for each construct.

Techniques: Luciferase, Reporter Assay, Construct, Expressing, Control, Quantitative RT-PCR, Binding Assay

(A) Schematic representation of MSI2-328 domains and their corresponding amino acid positions. (B,D) Schematics of MSI2 tethering constructs used in the reporter assays. (C,E) NanoLuc/Firefly luciferase ratios in H295R cells expressing the indicated tethering constructs (n = 6), normalized to λN-GFP control (red line). Statistical significance was determined using Student’s t-test relative to λN-GFP. (F) FLAG immunoprecipitation followed by western blot analysis of endogenous PABPC1 binding to FLAG-MSI2 constructs. FLAG-tagged proteins were immunoprecipitated and blots probed for PABPC1. Input samples (0.5%) are shown on the left and immunoprecipitated samples (50%) on the right. (G) NanoLuc/Firefly luciferase ratios in HEK293 cells following PABPC1 knockdown with two independent siRNAs (n = 4), normalized to λN-GFP control (red line). Statistical significance was determined using Student’s t-test relative to scramble siRNA controls for each construct. *p < 0.05, **p < 0.01, ***p < 0.001.

Journal: bioRxiv

Article Title: Isoform-Specific Localization Diversifies Human MSI2 Function

doi: 10.64898/2026.05.16.725683

Figure Lengend Snippet: (A) Schematic representation of MSI2-328 domains and their corresponding amino acid positions. (B,D) Schematics of MSI2 tethering constructs used in the reporter assays. (C,E) NanoLuc/Firefly luciferase ratios in H295R cells expressing the indicated tethering constructs (n = 6), normalized to λN-GFP control (red line). Statistical significance was determined using Student’s t-test relative to λN-GFP. (F) FLAG immunoprecipitation followed by western blot analysis of endogenous PABPC1 binding to FLAG-MSI2 constructs. FLAG-tagged proteins were immunoprecipitated and blots probed for PABPC1. Input samples (0.5%) are shown on the left and immunoprecipitated samples (50%) on the right. (G) NanoLuc/Firefly luciferase ratios in HEK293 cells following PABPC1 knockdown with two independent siRNAs (n = 4), normalized to λN-GFP control (red line). Statistical significance was determined using Student’s t-test relative to scramble siRNA controls for each construct. *p < 0.05, **p < 0.01, ***p < 0.001.

Article Snippet: MSI2 constructs were ordered from Twist Biosciences Corporation with a 5’ flank sequence of CAGGTGTCGGTACCGCGGGCCCGGGATCCA and a 3’ flank sequence of CTGGCTCACAAATACCACTGAGATC for each construct.

Techniques: Construct, Luciferase, Expressing, Control, Immunoprecipitation, Western Blot, Binding Assay, Knockdown

(A) Representative immunofluorescence images for endogenous MSI2 (green) and DAPI (blue) (scale bar, 10 μm). (B) - (C) Representative immunofluorescence images for GFP-tagged tethering MSI2-328 variants and mutants (green) and DAPI (blue), (scale bar, 10 μm).

Journal: bioRxiv

Article Title: Isoform-Specific Localization Diversifies Human MSI2 Function

doi: 10.64898/2026.05.16.725683

Figure Lengend Snippet: (A) Representative immunofluorescence images for endogenous MSI2 (green) and DAPI (blue) (scale bar, 10 μm). (B) - (C) Representative immunofluorescence images for GFP-tagged tethering MSI2-328 variants and mutants (green) and DAPI (blue), (scale bar, 10 μm).

Article Snippet: MSI2 constructs were ordered from Twist Biosciences Corporation with a 5’ flank sequence of CAGGTGTCGGTACCGCGGGCCCGGGATCCA and a 3’ flank sequence of CTGGCTCACAAATACCACTGAGATC for each construct.

Techniques: Immunofluorescence

(A) Schematic representation of MSI2 splice isoforms (MSI2-328 and MSI2-324) with their corresponding Ensembl transcript IDs and amino acid (aa) length. Exons are represented as black boxes, while isoform specific regions are highlighted in blue. (B,E) NanoLuc/Firefly luciferase ratios in H295R cells expressing the indicated tethering constructs, normalized to λN-GFP control. (C) Relative NanoLuc reporter mRNA expression measured by RT-qPCR and normalized to λN-GFP control. (D) Schematic representation of MSI2-324 constructs used for functional assays. Statistical significance was determined using Student’s t-test relative to λN-GFP control. *p < 0.05, **p < 0.01, ***p < 0.001. (F) - (G) Representative immunofluorescence images for GFP-tagged MSI2-324 variants and mutants (green) and DAPI (blue) (scale bar 10 μm).

Journal: bioRxiv

Article Title: Isoform-Specific Localization Diversifies Human MSI2 Function

doi: 10.64898/2026.05.16.725683

Figure Lengend Snippet: (A) Schematic representation of MSI2 splice isoforms (MSI2-328 and MSI2-324) with their corresponding Ensembl transcript IDs and amino acid (aa) length. Exons are represented as black boxes, while isoform specific regions are highlighted in blue. (B,E) NanoLuc/Firefly luciferase ratios in H295R cells expressing the indicated tethering constructs, normalized to λN-GFP control. (C) Relative NanoLuc reporter mRNA expression measured by RT-qPCR and normalized to λN-GFP control. (D) Schematic representation of MSI2-324 constructs used for functional assays. Statistical significance was determined using Student’s t-test relative to λN-GFP control. *p < 0.05, **p < 0.01, ***p < 0.001. (F) - (G) Representative immunofluorescence images for GFP-tagged MSI2-324 variants and mutants (green) and DAPI (blue) (scale bar 10 μm).

Article Snippet: MSI2 constructs were ordered from Twist Biosciences Corporation with a 5’ flank sequence of CAGGTGTCGGTACCGCGGGCCCGGGATCCA and a 3’ flank sequence of CTGGCTCACAAATACCACTGAGATC for each construct.

Techniques: Luciferase, Expressing, Construct, Control, Quantitative RT-PCR, Functional Assay, Immunofluorescence

(A) Heatmap of row-scaled z-scores of averaged protein intensities from EGFP, FLAG-MSI2-324, and FLAG-MSI2-328 immunoprecipitation mass spectrometry datasets clustered using k-means analysis. (B,C) Overrepresentation analysis of proteins enriched within MSI2-328 or MSI2-324 clusters identified in (A), showing significantly enriched Reactome pathways. (D) Volcano plot comparing protein enrichment between FLAG-MSI2-324 and FLAG-MSI2-328 immunoprecipitations. Significance thresholds were set at p < 0.05 and |log2FC| > 1. Translation-associated proteins enriched with MSI2-328 are highlighted in blue, while chromatin-and nuclear-associated proteins enriched with MSI2-324 are highlighted in orange. (E) Barplot of the number of MSI2 CLIP-seq peaks annotated to different transcript regions. (F) Scatter plot comparing enrichment of 6mers in MSI2 CLIP-seq peaks versus background regions for intronic binding sites (y-axis) and 3’ UTR binding sites (x-axis). The 6mers in red were enriched at least 4-fold in either intronic or 3’ UTR binding sites.

Journal: bioRxiv

Article Title: Isoform-Specific Localization Diversifies Human MSI2 Function

doi: 10.64898/2026.05.16.725683

Figure Lengend Snippet: (A) Heatmap of row-scaled z-scores of averaged protein intensities from EGFP, FLAG-MSI2-324, and FLAG-MSI2-328 immunoprecipitation mass spectrometry datasets clustered using k-means analysis. (B,C) Overrepresentation analysis of proteins enriched within MSI2-328 or MSI2-324 clusters identified in (A), showing significantly enriched Reactome pathways. (D) Volcano plot comparing protein enrichment between FLAG-MSI2-324 and FLAG-MSI2-328 immunoprecipitations. Significance thresholds were set at p < 0.05 and |log2FC| > 1. Translation-associated proteins enriched with MSI2-328 are highlighted in blue, while chromatin-and nuclear-associated proteins enriched with MSI2-324 are highlighted in orange. (E) Barplot of the number of MSI2 CLIP-seq peaks annotated to different transcript regions. (F) Scatter plot comparing enrichment of 6mers in MSI2 CLIP-seq peaks versus background regions for intronic binding sites (y-axis) and 3’ UTR binding sites (x-axis). The 6mers in red were enriched at least 4-fold in either intronic or 3’ UTR binding sites.

Article Snippet: MSI2 constructs were ordered from Twist Biosciences Corporation with a 5’ flank sequence of CAGGTGTCGGTACCGCGGGCCCGGGATCCA and a 3’ flank sequence of CTGGCTCACAAATACCACTGAGATC for each construct.

Techniques: Immunoprecipitation, Mass Spectrometry, Protein Enrichment, Binding Assay

(A) Western blot analysis of endogenous MSI2 protein expression across the indicated human cell lines. (B,C) NanoLuc/Firefly luciferase ratios from tethering assays performed in the indicated cell lines using MSI2 isoforms and mutant constructs. Reporter activity was normalized to λN-GFP control. Statistical significance was determined using Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001. (D) Stacked bar plot showing the median fraction of splice junction usage from the shared MSI2 exon 11 donor across GTEx tissue types. (E) Boxplots showing percent splice isoform values for the MSI2 exon 11 alternative acceptor event across TCGA cancer cohorts. Each point represents an individual tumor sample. Center lines indicate medians, boxes represent the interquartile range, and whiskers extend to 1.5X the interquartile range.

Journal: bioRxiv

Article Title: Isoform-Specific Localization Diversifies Human MSI2 Function

doi: 10.64898/2026.05.16.725683

Figure Lengend Snippet: (A) Western blot analysis of endogenous MSI2 protein expression across the indicated human cell lines. (B,C) NanoLuc/Firefly luciferase ratios from tethering assays performed in the indicated cell lines using MSI2 isoforms and mutant constructs. Reporter activity was normalized to λN-GFP control. Statistical significance was determined using Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001. (D) Stacked bar plot showing the median fraction of splice junction usage from the shared MSI2 exon 11 donor across GTEx tissue types. (E) Boxplots showing percent splice isoform values for the MSI2 exon 11 alternative acceptor event across TCGA cancer cohorts. Each point represents an individual tumor sample. Center lines indicate medians, boxes represent the interquartile range, and whiskers extend to 1.5X the interquartile range.

Article Snippet: MSI2 constructs were ordered from Twist Biosciences Corporation with a 5’ flank sequence of CAGGTGTCGGTACCGCGGGCCCGGGATCCA and a 3’ flank sequence of CTGGCTCACAAATACCACTGAGATC for each construct.

Techniques: Western Blot, Expressing, Luciferase, Mutagenesis, Construct, Activity Assay, Control